View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16151_low_22 (Length: 221)
Name: NF16151_low_22
Description: NF16151
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16151_low_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 65; Significance: 1e-28; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 141 - 209
Target Start/End: Original strand, 37264898 - 37264966
Alignment:
| Q |
141 |
atggcacattcaaggtatgtcgttattctcgcccttgtaatgttggccatgattggtcttgcctatgct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
37264898 |
atggcacattcaaggtatgtcgttattctcgcccttgtaatgttggccatgattggtctcgcctatgct |
37264966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 148 - 209
Target Start/End: Original strand, 37261132 - 37261193
Alignment:
| Q |
148 |
attcaaggtatgtcgttattctcgcccttgtaatgttggccatgattggtcttgcctatgct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37261132 |
attcaaggtatgtcgttattctcgcccttgtaatgttggccatgattggtcttgcctatgct |
37261193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 141 - 209
Target Start/End: Original strand, 37276848 - 37276916
Alignment:
| Q |
141 |
atggcacattcaaggtatgtcgttattctcgcccttgtaatgttggccatgattggtcttgcctatgct |
209 |
Q |
| |
|
||||||||||||||| |||| |||||||| |||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
37276848 |
atggcacattcaaggcatgttgttattctagcccttgtaatgttagccatgattggccttgcctatgct |
37276916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 141 - 209
Target Start/End: Original strand, 37280697 - 37280765
Alignment:
| Q |
141 |
atggcacattcaaggtatgtcgttattctcgcccttgtaatgttggccatgattggtcttgcctatgct |
209 |
Q |
| |
|
||||||| ||||||| |||| |||||||| |||||||||||||||||||||||||| ||| |||||||| |
|
|
| T |
37280697 |
atggcacgttcaaggcatgttgttattctggcccttgtaatgttggccatgattggccttacctatgct |
37280765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University