View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16152_high_5 (Length: 230)
Name: NF16152_high_5
Description: NF16152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16152_high_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 74 - 210
Target Start/End: Complemental strand, 32417191 - 32417053
Alignment:
| Q |
74 |
tctttctctttgatattgattc--gtttaatgtttgagttgccctaaaatcatgtccttgatataaagggttttctattcacaaagctaggaacaaactt |
171 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
32417191 |
tctttctctttgatattgattcttgtttaatgtttgagttggcctaaaatcatgtccttgatataaagcgttttctattcacaaagctaggaacaaactt |
32417092 |
T |
 |
| Q |
172 |
gaaggactttgtgctttcaccatgtcaccacctatgact |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32417091 |
gaaggactttgtgctttcaccatgtcaccacctatgact |
32417053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 49
Target Start/End: Complemental strand, 32417209 - 32417179
Alignment:
| Q |
19 |
atgaccagcaacttcacctctttctctttga |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
32417209 |
atgaccagcaacttcacctctttctctttga |
32417179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University