View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16152_low_13 (Length: 205)
Name: NF16152_low_13
Description: NF16152
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16152_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 2e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 136
Target Start/End: Complemental strand, 31532832 - 31532697
Alignment:
| Q |
1 |
catcctccaatttttgctctcccattgagacgatctctctaatcataaaggtatatcattcttgatcaatcacattgaaaatatatgttataattatgat |
100 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31532832 |
catcctctaatttttgctctcccatagagacgatctctctaatcataaaggtatatcattcttgatcaatcacattgaaaatatatgttataattatgat |
31532733 |
T |
 |
| Q |
101 |
ttggttattctattaaaattggggacccaatcaatc |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
31532732 |
ttggttattctattaaaattggggacccaatcaatc |
31532697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 162 - 192
Target Start/End: Complemental strand, 31532671 - 31532641
Alignment:
| Q |
162 |
tatggaacagttttggtatatatttacacca |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
31532671 |
tatggaacagttttggtatatatttacacca |
31532641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University