View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16153_low_4 (Length: 424)
Name: NF16153_low_4
Description: NF16153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16153_low_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 68 - 406
Target Start/End: Original strand, 33578966 - 33579307
Alignment:
| Q |
68 |
cgcgagattctctcttatatattaatatgcacaacctcactg--aaacacaagttgaccattctatattattcaacttggtactagatctctctggtttt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33578966 |
cgcgagattctctcttatatattaatatgcacaacctcactgtgaaacacaagttgaccattctatattattcaacttggtactagatctctctggtttt |
33579065 |
T |
|
| Q |
166 |
tgtcctttcctctgttttgattttaaggtttcagtcactccgagcactcaca--gcgtgttctttgaaactcggtcaaaatcattgcgcctccgctggag |
263 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33579066 |
tgtcctttcctctgttttgattgtaaggtttcagtcgctccgagcactcacacagcgtgttctttgaaactcggtcaaaatcattgcgcctccgctggag |
33579165 |
T |
|
| Q |
264 |
atatgcacaccattgtcagattctctcttttcatcactgtcttaccccccaccccagtcagcatcacagtagacatgtttgagagtttgtgaatgatttg |
363 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
33579166 |
acatgcacaccattgtcagattctctcttttcatcactgtcttaccccccaccccagtcagcatcacagtagacatg-ttgagagtttgtgaatgatttg |
33579264 |
T |
|
| Q |
364 |
ctaggatgaagatgtaacccactcaccccaattcagtcattca |
406 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33579265 |
ctaggatgaagatgtaacccactcaccccaattcagtcattca |
33579307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University