View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16153_low_9 (Length: 313)
Name: NF16153_low_9
Description: NF16153
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16153_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 32 - 298
Target Start/End: Complemental strand, 18993844 - 18993578
Alignment:
| Q |
32 |
ccaccatgcaccatgatatcctccatacacacatcctcacccgcctcgacgcctcgacgctggccaccaccgcctccacttgctctcacctccgccacct |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||| | ||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18993844 |
ccaccatgcaccatgatatcctccatacacacatcctcacccacctcgacgccgccacgctcgccaccactgcctccacttgctctcacctccgccacct |
18993745 |
T |
|
| Q |
132 |
ctgcatggataatgatctatggnnnnnnntctgcaccgagacgtggccgtcgttactagattctaccaccagccatgtcatctccactttcccaaatggt |
231 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18993744 |
ctgcatggataatgatctttggaaaaaaatctgcaccgagacgtggccgtcgttactagattctaccaccagccatgtcatctccactttcccaaatggt |
18993645 |
T |
|
| Q |
232 |
caccgttcgattttctcagacgcatttcccactcttcatcatttctcttctcattcaaaatcaaatc |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18993644 |
caccgttcgattttctcagacgcatttcccactcttcatcatttctcttctcattcaaaatcaaatc |
18993578 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University