View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16154_high_15 (Length: 280)
Name: NF16154_high_15
Description: NF16154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16154_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 18 - 152
Target Start/End: Complemental strand, 6123253 - 6123119
Alignment:
| Q |
18 |
atatgtcataggagttggttaggtggatggctcaagcctcagaagaagagttactttgctttgcaactccctaaacggtggtgggtttttgggcttgacc |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6123253 |
atatgttataggagttggttaggtggatggctcatgcctcagaagaagagttactttgctttgcaactccctaaacggtggtgggtttttgggcttgacc |
6123154 |
T |
 |
| Q |
118 |
ttgctcttcataatgatatagatgtgtaccaattc |
152 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| |
|
|
| T |
6123153 |
ttgctcttcataatgatatcgatgtgtaccaattc |
6123119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 163 - 271
Target Start/End: Complemental strand, 6123041 - 6122933
Alignment:
| Q |
163 |
tttaagtttgcttcataaagtctctactgtttaatgtgattttacttacataatttgtagagaattctttaagttttcattattagtcattcgtttgttg |
262 |
Q |
| |
|
|||||| ||||||||||||||||||| ||| ||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |||| || |
|
|
| T |
6123041 |
tttaagcttgcttcataaagtctctagtgtctaatgtgattttacttacataatttgtgcagaattctttaccttttcattattagtcattcatttgctg |
6122942 |
T |
 |
| Q |
263 |
ttgcctttg |
271 |
Q |
| |
|
||||||||| |
|
|
| T |
6122941 |
ttgcctttg |
6122933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University