View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16154_high_17 (Length: 226)
Name: NF16154_high_17
Description: NF16154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16154_high_17 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 52836643 - 52836425
Alignment:
| Q |
1 |
acaacatatggcaaaggaaaatgaatctcctattcctattattaggtcaagcaatatataaccattagagaatccaccctctttgctgaaggtgaatgac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52836643 |
acaacatatggcaaaggaaaatgaatctcctat-------attaggtcaagcaatatataaccattagagaatccaccctctttgctgaaggtgaatgac |
52836551 |
T |
|
| Q |
101 |
caaatttttaaagaggaaacatgtacctactcagacttcgaactttatcttctttggagcaggctggaggttacccacctgtaacagcaatgagacataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
52836550 |
caaatttttaaagaggaaacatgtacctactcagactttgaactttatcttctttggagcaggctggaggttgcccacctgtaacagcaattagacataa |
52836451 |
T |
|
| Q |
201 |
catggtgaaaatcagagacatggaca |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
52836450 |
catggtgaaaatcagagacatggaca |
52836425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 72; Significance: 7e-33; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 90 - 204
Target Start/End: Original strand, 48967386 - 48967501
Alignment:
| Q |
90 |
aggtgaatgaccaaatttttaaagaggaaacatgt-acctactcagacttcgaactttatcttctttggagcaggctggaggttacccacctgtaacagc |
188 |
Q |
| |
|
||||||||||| ||| ||||||||| ||| ||||| |||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| |||||| |
|
|
| T |
48967386 |
aggtgaatgactaaacttttaaagaagaagcatgttacctactcagtcttcgaactttatcttctttggagcagactggaggttacccacctgcaacagc |
48967485 |
T |
|
| Q |
189 |
aatgagacataacatg |
204 |
Q |
| |
|
||| ||||||| |||| |
|
|
| T |
48967486 |
aattagacatagcatg |
48967501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University