View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16155_high_7 (Length: 351)
Name: NF16155_high_7
Description: NF16155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16155_high_7 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 10 - 334
Target Start/End: Original strand, 19650529 - 19650853
Alignment:
| Q |
10 |
aagaatattcaatgccaacccaatctcctgcctgcttaattctttacctttttcaacccacttgtcgagagcagaatcaactgacaaacctgaaacactt |
109 |
Q |
| |
|
|||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19650529 |
aagactatttaatgccaacccaatctcctgcctgcttaattctttacctttttcaacccacttgtcgagagcagaatcaactgacaaacctgaaacactt |
19650628 |
T |
 |
| Q |
110 |
acaatcgccttgaatagttctgaccgtctccttgaagaaaatgattttttgtcagatgaatcagtctcagtatccgacaactccaggtcattgatgtcta |
209 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19650629 |
acaatggccttgaatagttctgaccgtctccttgaagaaaatgattttttgtcggatgaatcagtctcagtatccgacaactccagctcattgatgtcta |
19650728 |
T |
 |
| Q |
210 |
tttcagcagtgtcacggctatctccgtctgcatctggctcagtcaatcgatcttcaatctccatgtcatcatgatcatcagcatcatcctctttttggct |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19650729 |
tttcagcagtgtcacggctatctccgtctgcatctggctcagtcaatcgatcttcaatctccatgtcatcattatcatcagcatcatcctctttttggct |
19650828 |
T |
 |
| Q |
310 |
gctagcatcagcctgtgacgaaagt |
334 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
19650829 |
gctagcatcagcctgtgacgaaagt |
19650853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University