View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16155_low_17 (Length: 247)
Name: NF16155_low_17
Description: NF16155
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16155_low_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 9 - 230
Target Start/End: Complemental strand, 47589240 - 47589016
Alignment:
| Q |
9 |
cgaagaatatgaatatgcaaattatcttgctaagtatgatacttcctctccccttnnnnnnnn---gtatgatacttcctctaataaactccttcaagag |
105 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
47589240 |
cgaagaaaatgaatatgcaaattatcttgctaagtatgatacttcctctccccttaaaattaaaaagtatgatacttcctctgataaactccttcaagag |
47589141 |
T |
 |
| Q |
106 |
ttagtgtcattatccttccttagctgaacctgcaggttcacatgaaactgtaaattaatttgatcaagtacaacatagggaaggggtaaaatatacatta |
205 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
47589140 |
ttaatgtcattatccttccttagctgaacctgcaggttcacatgaaactgtaaattaatttgatcaagaacaacatagggaaggggtaaaatatacatta |
47589041 |
T |
 |
| Q |
206 |
ctagcacaaatgttttagaaaatac |
230 |
Q |
| |
|
||||||||||| ||||||||||||| |
|
|
| T |
47589040 |
ctagcacaaatcttttagaaaatac |
47589016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University