View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16157_high_10 (Length: 223)
Name: NF16157_high_10
Description: NF16157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16157_high_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 12680953 - 12680740
Alignment:
| Q |
1 |
tagtacagaattaatgccggaacagctcaagtttggccacatgcaaaataggttgggaacatgtacggtttggtatacacctttcatgttaccctttatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12680953 |
tagtacagaattaatgccggaacagctcaagtttggccacatgcaaaatagcttgggaacatgtacggtttggtatacacctttcatgttaccctttatc |
12680854 |
T |
|
| Q |
101 |
cttatgtgttgaattattgattacctgatttggttgtgcacagttaatcatctagagtcacttcttggaataattcgaaagggtaccctgcatcttaaac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12680853 |
cttatgtgttgaattattgattacctgatttggttgtgcacagttaatcatctagagtcacttcttggaataattcgaaagggtaccctgcatcttaaac |
12680754 |
T |
|
| Q |
201 |
cttttcttttcact |
214 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
12680753 |
cttttcttttcact |
12680740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University