View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16157_high_12 (Length: 216)
Name: NF16157_high_12
Description: NF16157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16157_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 14 - 197
Target Start/End: Original strand, 21428037 - 21428223
Alignment:
| Q |
14 |
cacagagggagggaaaaaacagacccataagtttcaaacgtctcactgcaagatatgcaatagaaattatttcacatctttccttacttcg---ataaga |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21428037 |
cacacagggagggaaaaaacagacccataagtttcaaacgtctcactgcaagacatgcaatagaaattatttcacatctttccttacttcttccataaga |
21428136 |
T |
|
| Q |
111 |
attgtggcttctaaaatctgtgagacttggatgtccgtaaaatcttttcttactgtcaaactgttttgactttttaactgtgattat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21428137 |
attgtggcttctaaaatctgtgagacttggatgtccgtaaaatcttttcttactgtcaaactgttttgactttttaactgtgattat |
21428223 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University