View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16157_high_8 (Length: 263)

Name: NF16157_high_8
Description: NF16157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16157_high_8
NF16157_high_8
[»] chr8 (2 HSPs)
chr8 (79-244)||(2434238-2434394)
chr8 (141-244)||(2430712-2430814)


Alignment Details
Target: chr8 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 79 - 244
Target Start/End: Original strand, 2434238 - 2434394
Alignment:
79 ctaaatccttacttgaaattaaattaaacgaacaattttggcaatttgtttcatacaaatacgttagataaatgtacaaaccaatgtgtggccagttgta 178  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
2434238 ctaaatcgttacttgaaattaaattaaacgaacaattttggcaatttgtttcatacaaatacgttagataaatgtacaaaccaatgtgtggccagttcta 2434337  T
179 ttagacgtacatgtacaacacaaacaccacaaagatttttgtgacacaattcgtgagatggcggaa 244  Q
    |         ||||||||||||||||||||||||||||| |||||||||||| |||||||||||||    
2434338 t---------atgtacaacacaaacaccacaaagattttagtgacacaattcctgagatggcggaa 2434394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 141 - 244
Target Start/End: Original strand, 2430712 - 2430814
Alignment:
141 gttagataaatgtacaaaccaatgtgtggccagttgtattagacgt--acatgtacaacacaaacaccacaaagatttttgtgacacaattcgtgagatg 238  Q
    ||||||| |||||||| ||||   ||||||||||||||||||| ||  |||||||||||||||||||||||||||||||||  ||||||||| |||||||    
2430712 gttagatgaatgtacagacca---tgtggccagttgtattagatgtgtacatgtacaacacaaacaccacaaagatttttgcaacacaattcctgagatg 2430808  T
239 gcggaa 244  Q
    ||||||    
2430809 gcggaa 2430814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University