View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16157_low_11 (Length: 223)

Name: NF16157_low_11
Description: NF16157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16157_low_11
NF16157_low_11
[»] chr2 (1 HSPs)
chr2 (1-214)||(12680740-12680953)


Alignment Details
Target: chr2 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 12680953 - 12680740
Alignment:
1 tagtacagaattaatgccggaacagctcaagtttggccacatgcaaaataggttgggaacatgtacggtttggtatacacctttcatgttaccctttatc 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
12680953 tagtacagaattaatgccggaacagctcaagtttggccacatgcaaaatagcttgggaacatgtacggtttggtatacacctttcatgttaccctttatc 12680854  T
101 cttatgtgttgaattattgattacctgatttggttgtgcacagttaatcatctagagtcacttcttggaataattcgaaagggtaccctgcatcttaaac 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12680853 cttatgtgttgaattattgattacctgatttggttgtgcacagttaatcatctagagtcacttcttggaataattcgaaagggtaccctgcatcttaaac 12680754  T
201 cttttcttttcact 214  Q
    ||||||||||||||    
12680753 cttttcttttcact 12680740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University