View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16157_low_9 (Length: 263)
Name: NF16157_low_9
Description: NF16157
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16157_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 79 - 244
Target Start/End: Original strand, 2434238 - 2434394
Alignment:
| Q |
79 |
ctaaatccttacttgaaattaaattaaacgaacaattttggcaatttgtttcatacaaatacgttagataaatgtacaaaccaatgtgtggccagttgta |
178 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2434238 |
ctaaatcgttacttgaaattaaattaaacgaacaattttggcaatttgtttcatacaaatacgttagataaatgtacaaaccaatgtgtggccagttcta |
2434337 |
T |
|
| Q |
179 |
ttagacgtacatgtacaacacaaacaccacaaagatttttgtgacacaattcgtgagatggcggaa |
244 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
2434338 |
t---------atgtacaacacaaacaccacaaagattttagtgacacaattcctgagatggcggaa |
2434394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 141 - 244
Target Start/End: Original strand, 2430712 - 2430814
Alignment:
| Q |
141 |
gttagataaatgtacaaaccaatgtgtggccagttgtattagacgt--acatgtacaacacaaacaccacaaagatttttgtgacacaattcgtgagatg |
238 |
Q |
| |
|
||||||| |||||||| |||| ||||||||||||||||||| || ||||||||||||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
2430712 |
gttagatgaatgtacagacca---tgtggccagttgtattagatgtgtacatgtacaacacaaacaccacaaagatttttgcaacacaattcctgagatg |
2430808 |
T |
|
| Q |
239 |
gcggaa |
244 |
Q |
| |
|
|||||| |
|
|
| T |
2430809 |
gcggaa |
2430814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University