View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16159_high_22 (Length: 269)
Name: NF16159_high_22
Description: NF16159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16159_high_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 28 - 258
Target Start/End: Complemental strand, 37975886 - 37975655
Alignment:
| Q |
28 |
ccataacaccacaagtcacaacatcatagcaaaatcaa--gtcttttggagctgcaagttagtaacaacattaaaatataaatttgtgaaattttggatc |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37975886 |
ccataacaccacaagtcacaacatcatagcaaaatcaatagtcttttggagctgcaagttagtaacaacattaaaatataaatttgtgaaattttggatc |
37975787 |
T |
 |
| Q |
126 |
aaatattgtaaaccatcccacaatcccgtcatctctcatacttgtctcgccttagcatatcccaagaacaagtatcaatcgttctcatagctagtttgtt |
225 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37975786 |
aaatattgtaaaccatcc-acaatcccgtcatctctcatacttgtctcgccttagcatatcccaagaacaagtatcaatcgttctcatagctagtttgtt |
37975688 |
T |
 |
| Q |
226 |
taacattgccaaattcctcgtcatccctttcat |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37975687 |
taacattgccaaattcctcgtcatccctttcat |
37975655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University