View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16159_low_14 (Length: 369)
Name: NF16159_low_14
Description: NF16159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16159_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 247 - 295
Target Start/End: Complemental strand, 27721886 - 27721838
Alignment:
| Q |
247 |
gaaggtacaaaattctgtgcagtttcaaaagaactgcacaggggttgtt |
295 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27721886 |
gaaggtataaaattctgtgcagtttcaaaagaactgcacaggggttgtt |
27721838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 111 - 152
Target Start/End: Complemental strand, 27722031 - 27721990
Alignment:
| Q |
111 |
gaccaggatcttcttacgtttttgtaagtacatgaactgcac |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27722031 |
gaccaggatcttcttacgtttttgtaagtacatgaactgcac |
27721990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 323 - 358
Target Start/End: Complemental strand, 27721842 - 27721807
Alignment:
| Q |
323 |
ttgtttgttattgaggaagaacaacgtgtgatgatg |
358 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
27721842 |
ttgtttgttattgaggaagaacaacgtgtgatgatg |
27721807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University