View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
	Query
	Query hiting target	Query hiting target's complemental strand
	Query's complemental strand hiting target	Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16159_low_14 (Length: 369)

Name: NF16159_low_14

Description: NF16159

Algorithm: BLASTN 2.2.26 [Sep-21-2011]

Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)

[»] NF16159_low_14

[»] chr7 (3 HSPs)

Target: chr7 (Bit Score: 45; Significance: 1e-16; HSPs: 3)

Name: chr7

Description:

Target: chr7; HSP #1

Raw Score: 45; E-Value: 1e-16

Query Start/End: Original strand, 247 - 295

Target Start/End: Complemental strand, 27721886 - 27721838

Alignment:

Q	247	gaaggtacaaaattctgtgcagtttcaaaagaactgcacaggggttgtt	295	Q
		\|\|\|\|\|\|\| \|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	27721886	gaaggtataaaattctgtgcagtttcaaaagaactgcacaggggttgtt	27721838	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2

Raw Score: 42; E-Value: 0.000000000000009

Query Start/End: Original strand, 111 - 152

Target Start/End: Complemental strand, 27722031 - 27721990

Alignment:

Q	111	gaccaggatcttcttacgtttttgtaagtacatgaactgcac	152	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	27722031	gaccaggatcttcttacgtttttgtaagtacatgaactgcac	27721990	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3

Raw Score: 36; E-Value: 0.00000000003

Query Start/End: Original strand, 323 - 358

Target Start/End: Complemental strand, 27721842 - 27721807

Alignment:

Q	323	ttgtttgttattgaggaagaacaacgtgtgatgatg	358	Q
		\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|\|
T	27721842	ttgtttgttattgaggaagaacaacgtgtgatgatg	27721807	T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]