View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16159_low_25 (Length: 248)
Name: NF16159_low_25
Description: NF16159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16159_low_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 9 - 230
Target Start/End: Complemental strand, 42810789 - 42810568
Alignment:
| Q |
9 |
agtgagatgaactgatttggttttgatgtagtcacaaattctacgctttcactcaatcaatacagcggtgccatttatgagaaagtggctaacttttagt |
108 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42810789 |
agtgaaatgaactgatttggttttgatgtagtcacaaattctacgctttcactcaatcaatacagcggtgccatttatgagaaagtggctaacttttagt |
42810690 |
T |
 |
| Q |
109 |
gtagataaaaaatttatgtgaggaatgaaatagcaaactattgcgctacattaatttatatcgtgtgttttacttttaaatatacataatagctgnnnnn |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
42810689 |
gtagataaaaaatttatgtgaggaatgaaatagcaaactattgcgctacattaatttatattgtgtgttttacttttaaatatacataatagttgttttt |
42810590 |
T |
 |
| Q |
209 |
nngttgttctttatcctgtaat |
230 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42810589 |
ttgttgttctttatcctgtaat |
42810568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University