View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1615_high_3 (Length: 288)
Name: NF1615_high_3
Description: NF1615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1615_high_3 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 4 - 288
Target Start/End: Original strand, 40997770 - 40998049
Alignment:
| Q |
4 |
aattaagctaaaaaataatattattagcaaaatagaggaagtaagtaagagaaaattaaagagatatattatatgtggtttatttttnnnnnnnnnnnnn |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40997770 |
aattaagctaaaaaataatattattagcaaaatagaggaagtaagtaagagaaaattaaagagatatattatatgtggtttatttttaaaataaaa---- |
40997865 |
T |
 |
| Q |
104 |
ttataattttttaatggtgattattattgtttatatatttctgcgaaatgagcactgctctcttggtttttgaatcaaacatgaagaatcaagattcagt |
203 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40997866 |
ttgtaattttttaatggtgattattattgtttatatatttctgcgaaatgagcactgctctcttggtttttgaatcaaacatgaagaatcaagattcagt |
40997965 |
T |
 |
| Q |
204 |
ctatgagtcattgcaacgtaaaataaatgatatgttatgtaatcttttaatgcatagacaaatcatcacaatgtgtcggtgcaac |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40997966 |
ctatgagtcattgcaacgtaaaataaatgatatgttctgtaat-ttttaatgcatagacaaatcatcacaatgtgtaggtgcaac |
40998049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University