View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1615_low_11 (Length: 212)
Name: NF1615_low_11
Description: NF1615
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1615_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 35 - 193
Target Start/End: Complemental strand, 25493127 - 25492967
Alignment:
| Q |
35 |
ttagatccatatgaaaatgcagatgagc--aagttagcaaatatgcaatgcaattttcaattcataatactacaacatttaggacctttagtaacaataa |
132 |
Q |
| |
|
|||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
25493127 |
ttagatgcatatgaaaatgcagatgagcgcaagttagcaaatatgcaatgcaattttcaattcataatgctacaacatttaggacctttagtaacaataa |
25493028 |
T |
 |
| Q |
133 |
tatttttcaaatgttactaaatctcatttttgttgtattgtaagtacagggagagaccaaa |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |||||||||| |||||| ||||| |
|
|
| T |
25493027 |
tatttttcaaatgttactaaatctcatttttattgtagtgtaagtacatggagaggccaaa |
25492967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 130 - 169
Target Start/End: Complemental strand, 26173823 - 26173784
Alignment:
| Q |
130 |
taatatttttcaaatgttactaaatctcatttttgttgta |
169 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
26173823 |
taatattttttaagtgttactaaatctcatttttgttgta |
26173784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 134 - 166
Target Start/End: Original strand, 9438791 - 9438823
Alignment:
| Q |
134 |
atttttcaaatgttactaaatctcatttttgtt |
166 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
9438791 |
atttttcaagtgttactaaatctcatttttgtt |
9438823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University