View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1616-INSERTION-6 (Length: 552)
Name: NF1616-INSERTION-6
Description: NF1616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1616-INSERTION-6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 4e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 480 - 552
Target Start/End: Complemental strand, 47212886 - 47212814
Alignment:
| Q |
480 |
aagcttgcttgtttggcgaatccgaaaacaacaactcttgaaacatcatacaacaaagttcatgaaggaaggt |
552 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47212886 |
aagcttgcttgtttggcgaatccgaaaacaacaactcttgaaacatcatacaacaaagttcatgaaggaaggt |
47212814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University