View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16160_low_16 (Length: 245)
Name: NF16160_low_16
Description: NF16160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16160_low_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 113 - 238
Target Start/End: Complemental strand, 5041996 - 5041870
Alignment:
| Q |
113 |
atgttccatcacttcca-cataaaagcctattatttttaccaatatattgcttcttcctactttctatagtgtcattcagtttgtgctattttgcttcat |
211 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5041996 |
atgttccatcacttccaacataaaagcctattttttttaccaatatattgcttcttcctactttctatagtgtcattcagtttgtgctattttgcttcat |
5041897 |
T |
|
| Q |
212 |
cttttacaatcagtcccttcacttctc |
238 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
5041896 |
cttttacaatcagtcccttcacttctc |
5041870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 18 - 52
Target Start/End: Complemental strand, 5042091 - 5042057
Alignment:
| Q |
18 |
gtttggatagaggctcgtcaaccaaaggagaggta |
52 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
5042091 |
gtttggatagaggctcgtcaaccaaaggagaggta |
5042057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University