View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16160_low_17 (Length: 217)
Name: NF16160_low_17
Description: NF16160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16160_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 39 - 198
Target Start/End: Original strand, 529992 - 530151
Alignment:
| Q |
39 |
aacctgtggctacaacgatggaaatcgcaacatacgaatctatagtccttgcccgacatgtgattggagtgaaatcgacggcggactttctgccgagaga |
138 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
529992 |
aaccggtggctacaacgatggaaatcgcaacatacgaatctatagtccttgcccgacatgtgattggagtgaaatcgacggcggactttctgccgagaga |
530091 |
T |
|
| Q |
139 |
tggtatgccaccagccatatcctccctaatggtagtcagattgttgttggtggtaggggg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
530092 |
tggtatgccaccagccatatcctccctaatggtagtcagattgttgttggtggtaggggg |
530151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University