View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16160_low_4 (Length: 525)
Name: NF16160_low_4
Description: NF16160
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16160_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-116; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-116
Query Start/End: Original strand, 142 - 408
Target Start/End: Complemental strand, 40994066 - 40993806
Alignment:
| Q |
142 |
tcaaacatcatattctcttctctcctcgtaaacacctcccatgtcgtgccatatatctataaaagtagttttatgacatctgacttaataaactctatga |
241 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40994066 |
tcaaacatcatattctcttctctcttcgtaaacacctcccatgtcgtgccatatatctataaaagtagttttatgacatctgacttaataaactctatga |
40993967 |
T |
 |
| Q |
242 |
tatagctattcgagttctaagtattaccacatactcaacaaagcctataccaacatccaaacttgtttagacttggtagttatgttcaactgtcatatac |
341 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40993966 |
tatagttattcgagctctaagtattaccacatactcaacaaagcctataccaacatccaaacttgtttagacttggtagttatgttcaactgtc------ |
40993873 |
T |
 |
| Q |
342 |
tcatatgagaatcaattcaa--ctcagtcaattttgcatctatattagttggttgcaatggagttgata |
408 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40993872 |
--atatgagaatcaattcaactctcagtcaattttgcatctatattagttggttgcaatggacttgata |
40993806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 439 - 496
Target Start/End: Complemental strand, 40993813 - 40993756
Alignment:
| Q |
439 |
acttgatattaacatgtgatgatacagatttattgtctaacaatgataatcatcaatg |
496 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40993813 |
acttgatattaacatgtgattatacagatttattgtctaacaatgataatcatcaatg |
40993756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 111 - 147
Target Start/End: Complemental strand, 40994114 - 40994078
Alignment:
| Q |
111 |
agtgtggatgttttatcgaaatttttgcccttcaaac |
147 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40994114 |
agtgtggatgttttatcaaaatttttgcccttcaaac |
40994078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University