View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16162_high_7 (Length: 252)
Name: NF16162_high_7
Description: NF16162
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16162_high_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 51679004 - 51678771
Alignment:
| Q |
1 |
gaaactgatattctgaaaaaggagtcctaaaatgggtcagatattgaatgccaccc-ctctataatacattgttcacgtcatattcaaccagtgcagtgc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51679004 |
gaaactgatattctgaaaaaggagtcctaaaatgggtcagatattgaatgccaccctctctataatacatggttcacgtcatattcaaccagtgcagtgc |
51678905 |
T |
|
| Q |
100 |
acgacctgtcatacaactaattcaaaaatatactgttaaaatgaagatctaatattgtgtagtaatctaatttgtagatatttatttgccggtacaaaaa |
199 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
51678904 |
acgacctgtcatacaattaattcaaaaatatactattaaaatgaagatctaatattgtgtagtaatctaatttgtagat----atttgccggtacaaaaa |
51678809 |
T |
|
| Q |
200 |
ttatttggcagtttcccagcatacgagagttactaatt |
237 |
Q |
| |
|
||||||||||||||||||||||| |||| ||| ||||| |
|
|
| T |
51678808 |
ttatttggcagtttcccagcatatgagatttattaatt |
51678771 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University