View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16163_high_3 (Length: 389)
Name: NF16163_high_3
Description: NF16163
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16163_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 1e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 18 - 175
Target Start/End: Complemental strand, 382649 - 382492
Alignment:
| Q |
18 |
gtttgcagagagatccgtcgaggagatggactgcttcgaggttgctttcacatccttttcttgtgagaaatggttctaatcataatcagagtcctccaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
382649 |
gtttgcagagagatccgtcgaggagatggactgcttcgaggttgctttcacatccttttcttgtgagaaatggttctaatcataatcagagtcctccaaa |
382550 |
T |
 |
| Q |
118 |
tatgcatcagttacttcctccaccaccaagatcacaatcttcttagttcggcaatgta |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
382549 |
tatgcatcagttacttcctccaccaccaagatcacaatcttcttagttcgtcaatgta |
382492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 233 - 381
Target Start/End: Complemental strand, 382437 - 382282
Alignment:
| Q |
233 |
ttgaagaagaactgaattggtagcatcagatgctgattg-------ctgatttcaatcactattacatgaatctagaacttttatttttggttatctttc |
325 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
382437 |
ttgaagaagaactgaattggtagcatcagatgctgattgaagattgctgatttcaatcactattacatgaatctagaacttttatttttggttatctcta |
382338 |
T |
 |
| Q |
326 |
ttattataaatgttattatgaatgaatgtaacaaaatgtaatccaatgcctatgct |
381 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
382337 |
ttattataaatgttattatgaatgaatgtaacaaaatgtaatccaatgcttatgct |
382282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University