View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16165_high_20 (Length: 245)
Name: NF16165_high_20
Description: NF16165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16165_high_20 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 105; Significance: 1e-52; HSPs: 5)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 3081047 - 3080935
Alignment:
| Q |
1 |
tttattttggtgctataaaatttgtattcatttttagtccttaaatttattttaaaatagtgtgtttttagcttttacttgggattaaaatcacacaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3081047 |
tttattttggtgctataaaatttgtattcagttttagtccttaaagttattttaaaatagtgtgtttttagcttttacttgggattaaaatcacacaatt |
3080948 |
T |
|
| Q |
101 |
tagattttagaca |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3080947 |
tagattttagaca |
3080935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 1 - 113
Target Start/End: Complemental strand, 3095484 - 3095372
Alignment:
| Q |
1 |
tttattttggtgctataaaatttgtattcatttttagtccttaaatttattttaaaatagtgtgtttttagcttttacttgggattaaaatcacacaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3095484 |
tttattttggtgctataaaatttgtattcagttttagtccttaaagttattttaaaatagtgtgtttttagcttttacttgggattaaaatcacacaatt |
3095385 |
T |
|
| Q |
101 |
tagattttagaca |
113 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3095384 |
tagattttagaca |
3095372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 179 - 229
Target Start/End: Complemental strand, 3080868 - 3080818
Alignment:
| Q |
179 |
atatttaacccattgatttcttactaatattaaaaggtatgactcacatat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3080868 |
atatttaacccattgatttcttactaatattaaaaggtatgactcacatat |
3080818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 179 - 229
Target Start/End: Complemental strand, 3095305 - 3095255
Alignment:
| Q |
179 |
atatttaacccattgatttcttactaatattaaaaggtatgactcacatat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3095305 |
atatttaacccattgatttcttactaatattaaaaggtatgactcacatat |
3095255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 54 - 111
Target Start/End: Original strand, 4547481 - 4547538
Alignment:
| Q |
54 |
aaaatagtgtgtttttagcttttacttgggattaaaatcacacaatttagattttaga |
111 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
4547481 |
aaaatagtgtgttattagcttttacttgggactaaaatcatacaatttagattttaga |
4547538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University