View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16165_high_21 (Length: 242)
Name: NF16165_high_21
Description: NF16165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16165_high_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 2 - 224
Target Start/End: Original strand, 4110361 - 4110583
Alignment:
| Q |
2 |
aagaagggtaaattgtagttttaaatttagattttttaatcaagcttggcttgattggttgcatgtgtctttagcttcacaagctaccaatgatagggac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4110361 |
aagaagggtaaattgtagttttaaatttagattttttaatcaagcttggcttgattggttgcatgtgtctttagcttcacaagctaccaatgatagggac |
4110460 |
T |
|
| Q |
102 |
aatcatgaacgtccaaatgaggaagtagcttttttgtttctagttattgacttcttgtcccctgctggggttttgccgttaaggaacaaagagagttttc |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4110461 |
aatcatgaacgtccaaatgaggaagtagcttttttgtttctagttattgacttcttgtcccctgctggggttttgccgttaaggaacaaagagagttttc |
4110560 |
T |
|
| Q |
202 |
tcaaagtagtactttggaaaaca |
224 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
4110561 |
tcaaagtagtactttggaaaaca |
4110583 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University