View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16165_low_19 (Length: 282)
Name: NF16165_low_19
Description: NF16165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16165_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 59 - 266
Target Start/End: Original strand, 15754213 - 15754418
Alignment:
| Q |
59 |
ttcattactcatgtttatatatgtttatcattgaatttgatagtttatgatctataattaaattctactattatatttatagataactgcgcagtacaat |
158 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
15754213 |
ttcattactcatgtttatat--gttgatcattgaatttgatagtttatgatctataattaaattctactattatatttatagataactgcgaagtacaat |
15754310 |
T |
|
| Q |
159 |
ttcaaagacctgagatttctaccaagaaaaataactgcgaagaaactctagttggagttttcagcctagttgatgcttgtagatcaggtgctttagaggc |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15754311 |
ttcaaagacctgagatttctaccaagaaaaataactgtgaagaaactctagttggagttttcagcctagttgatgcttgtagatcaggtgctttagaggc |
15754410 |
T |
|
| Q |
259 |
aatggaag |
266 |
Q |
| |
|
|||||||| |
|
|
| T |
15754411 |
aatggaag |
15754418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University