View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16165_low_22 (Length: 269)
Name: NF16165_low_22
Description: NF16165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16165_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 25 - 250
Target Start/End: Complemental strand, 49064636 - 49064411
Alignment:
| Q |
25 |
ctttgggcgtatcaagaggaccaaaaataagtgatgcaatcacgcatgatnnnnnnnggagacagagccaaacattatggtttgtcatgtacatgaatgt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49064636 |
ctttgggcgtatcaagaggaccaaaaataagtgatgcaatcacgcatgataaaaaaaggagacagagccaaacattatggtttgtcatgtacatgaatgt |
49064537 |
T |
|
| Q |
125 |
taccaataccaaacaaacttcttatgtacttaaacgtctatcagcaaggacaccatgtccccattcgttgttgacgtttccctttgcatcttatactacc |
224 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49064536 |
taccaataccaaacaaacttcttatttacttaaacgtctatcagcaaggacaccatgtccccattcgttgttgacgtttccctttgcatcttatactacc |
49064437 |
T |
|
| Q |
225 |
tttttctttcaaatgaattctccctc |
250 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
49064436 |
tttttctttcaaatgaattctccctc |
49064411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University