View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16165_low_27 (Length: 235)
Name: NF16165_low_27
Description: NF16165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16165_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 27 - 224
Target Start/End: Original strand, 26195595 - 26195792
Alignment:
| Q |
27 |
aaagaggattagacaagacacacttttaaatacgtttagaatgttaggcctacttaatctccctcttttgggccgtaaatttatgtgtgttcaatcggat |
126 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
26195595 |
aaagaggattagacaagacacacttttaaatacgtttggaatgttaggcctacttaatctccctcttttgggccgtaaatttacatgtgttcaatcggat |
26195694 |
T |
 |
| Q |
127 |
gatatatgcttgagtcgtttggattggatcttactctcaccaaatggtttgtgttttggggtgaagctaacctttgggctttgtcatgggatgtttca |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26195695 |
gatatatgcttgagtcgtttggattggatcttactctcaccaaatggtttgtgttttggggtgaagctaacctttgggctttgtcatgggatgtttca |
26195792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University