View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16165_low_27 (Length: 235)

Name: NF16165_low_27
Description: NF16165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16165_low_27
NF16165_low_27
[»] chr4 (1 HSPs)
chr4 (27-224)||(26195595-26195792)


Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 27 - 224
Target Start/End: Original strand, 26195595 - 26195792
Alignment:
27 aaagaggattagacaagacacacttttaaatacgtttagaatgttaggcctacttaatctccctcttttgggccgtaaatttatgtgtgttcaatcggat 126  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||    
26195595 aaagaggattagacaagacacacttttaaatacgtttggaatgttaggcctacttaatctccctcttttgggccgtaaatttacatgtgttcaatcggat 26195694  T
127 gatatatgcttgagtcgtttggattggatcttactctcaccaaatggtttgtgttttggggtgaagctaacctttgggctttgtcatgggatgtttca 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26195695 gatatatgcttgagtcgtttggattggatcttactctcaccaaatggtttgtgttttggggtgaagctaacctttgggctttgtcatgggatgtttca 26195792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University