View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16165_low_29 (Length: 229)
Name: NF16165_low_29
Description: NF16165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16165_low_29 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 20 - 211
Target Start/End: Complemental strand, 46011890 - 46011698
Alignment:
| Q |
20 |
atacggggactggtaaggaatgtgaagagagtggaagctgaaatagcagcattaaagatttcatatctgaagaaaatcaacaaaggcaccagcattgtga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
46011890 |
atacggggactggtaaggaatgtgaagagagtggaagctgaaatagcagcattaaagatttcatatctgaagaaaatcaacaaaggcaccaacattgtga |
46011791 |
T |
 |
| Q |
120 |
tcttggactcgtaggtttcctttc-aaatctatcttactattaactaaccattttcagttcactatatggcggatgattatctacgagacaca |
211 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46011790 |
tcttggactcgtaggtttcctttcaaaaactatcttactattaactaaccattttcagttcactatatggcggatgattatctacgagacaca |
46011698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University