View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16165_low_9 (Length: 406)
Name: NF16165_low_9
Description: NF16165
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16165_low_9 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 167; Significance: 2e-89; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 7327393 - 7327219
Alignment:
| Q |
1 |
aatgaggtgcgtttgcaagctgtggaattctctggtcgttgatcctaaaatgatgaagaagcactttcacagattttccactgaagtcgctgatctaact |
100 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7327393 |
aatgaggtgcgtttgcaagctgcggaaatctctggtcgttgatcctaaaatgatgaagaagcactttcacagattttccactgaagtcgctgatctaact |
7327294 |
T |
|
| Q |
101 |
tctaaggccaagaaacacatcaatgcttttaaatcgcagcatccagaacaagatactggtgttgaagatgctgct |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7327293 |
tctaaggccaagaaacacatcaatgcttttaaatcgcagcatccagaacaagatactggtgttgaagatgctgct |
7327219 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 205 - 271
Target Start/End: Complemental strand, 7327189 - 7327123
Alignment:
| Q |
205 |
cgacgatgctactccagataaagacaaattgaaacaatggttgatgattgacgttgatcatttggat |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7327189 |
cgacgatgctactccagataaagacaaattgaaacaatggttgatgattgacgttgatcatttggat |
7327123 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University