View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16166_high_2 (Length: 314)
Name: NF16166_high_2
Description: NF16166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16166_high_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 151; Significance: 7e-80; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 17 - 167
Target Start/End: Complemental strand, 28500520 - 28500370
Alignment:
| Q |
17 |
attttatcccaacaaaagaaagagatggttaaatgattgtctctttgctttgtgagattatcaactcattcattaattatatgagtgtgattgtaaggtg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28500520 |
attttatcccaacaaaagaaagagatggttaaatgattgtctctttgctttgtgagattatcaactcattcattaattatatgagtgtgattgtaaggtg |
28500421 |
T |
|
| Q |
117 |
gggtgtccttgtcactcaagtaatccccaaacctatcgtgtttagttaggg |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28500420 |
gggtgtccttgtcactcaagtaatccccaaacctatcgtgtttagttaggg |
28500370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 217 - 304
Target Start/End: Complemental strand, 28500320 - 28500233
Alignment:
| Q |
217 |
ctataattgtggaattaattcctttcaatagcgagtgaaacagtgatgactctttaataattgacctatttgaatcttcttcattctt |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28500320 |
ctataattgtggaattaattcctttcaatagcgagtgaaacagtgatgactctttaataattgacctatttgaatcttcttcattctt |
28500233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University