View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16166_high_5 (Length: 207)
Name: NF16166_high_5
Description: NF16166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16166_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 127; Significance: 9e-66; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 127; E-Value: 9e-66
Query Start/End: Original strand, 17 - 191
Target Start/End: Complemental strand, 3195902 - 3195728
Alignment:
| Q |
17 |
agataatttgtcccaaaatagccacttcacacctttatttttgttaccttcattgcaccaccnnnnnnnnttgatcatatgatctattttgtctccaata |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |||||||||||||| | |
|
|
| T |
3195902 |
agataatttgtcccaaaatagccacttcacacctttatttttgttcccttcattgcaccacccaaaagaattgatcatatgatttattttgtctccaaga |
3195803 |
T |
|
| Q |
117 |
gatgaaagagtttgatcatgacctctttactcgctttagataaagatttggccccctccctactacatcttcttc |
191 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
3195802 |
gatgaaagagtttgatcatgacctttttactcgctttagataaagatttggccccctccttactagatcttcttc |
3195728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University