View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16166_low_4 (Length: 209)
Name: NF16166_low_4
Description: NF16166
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16166_low_4 |
 | |
|
| [»] scaffold0044 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 154; Significance: 7e-82; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 154; E-Value: 7e-82
Query Start/End: Original strand, 17 - 194
Target Start/End: Complemental strand, 14132669 - 14132492
Alignment:
| Q |
17 |
agggagaagtaaaactcattgagccaacggagttaattgacagaccttgaacattaccaatgtgcacctagtcagaacctgatagggaaacatcgtctgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| || || |
|
|
| T |
14132669 |
agggagaagtaaaactcattgagccaacagagttaattgacagaccttgaacattaccaatgtgcatctggtcagaacctgatagggaaacatcatccgt |
14132570 |
T |
|
| Q |
117 |
aagattgttagcatcaggagtaacatgatgtgtggaaccagaatcaggataccagccaatattgaaggagtgggagct |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14132569 |
aagattgttagcatcaggagtaacatgatgtgtggaaccagaatcaggataccagccaatattgaaggagttggagct |
14132492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 17 - 192
Target Start/End: Complemental strand, 76592 - 76417
Alignment:
| Q |
17 |
agggagaagtaaaactcattgagccaacggagttaattgacagaccttgaacattaccaatgtgcacctagtcagaacctgatagggaaacatcgtctgt |
116 |
Q |
| |
|
||||||| ||||| ||| |||||||| |||||||| | |||||||||| |||| |||||||| || | |||||||||||| |||||||| | || | |
|
|
| T |
76592 |
agggagaggtaaatttcagtgagccaatagagttaataggcagaccttgaccatttccaatgtgaacttggtcagaacctgacagggaaactgcatccat |
76493 |
T |
|
| Q |
117 |
aagattgttagcatcaggagtaacatgatgtgtggaaccagaatcaggataccagccaatattgaaggagtgggag |
192 |
Q |
| |
|
|| ||| | |||||||| || |||||||| |||| |||||||||||| ||||||||| | || ||||||| |||| |
|
|
| T |
76492 |
gaggttggtggcatcaggtgtcacatgatgagtggcaccagaatcagggtaccagccagtgttaaaggagttggag |
76417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University