View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16167_low_8 (Length: 236)
Name: NF16167_low_8
Description: NF16167
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16167_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 91 - 204
Target Start/End: Complemental strand, 34256740 - 34256628
Alignment:
| Q |
91 |
atacggatatatagaaagatagatttatttcaaaaaatgtccaaaggagtgaagatagtagcaaaaattgtacttagtt-ccaaataatgactcaaaact |
189 |
Q |
| |
|
||||||||||| ||||||| | ||||||| ||||||| ||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| |||| |
|
|
| T |
34256740 |
atacggatatagagaaagacaaatttattgcaaaaaaagtccaaaggagtgaagatagtagcaaaaaatgtacttagttcccaaataatgactc--aact |
34256643 |
T |
|
| Q |
190 |
gggaaaaattgaaca |
204 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
34256642 |
gggaaaaattgaaca |
34256628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 28 - 61
Target Start/End: Complemental strand, 34256769 - 34256736
Alignment:
| Q |
28 |
tcttcaagactaaaccaagtcaatctagaatacg |
61 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
34256769 |
tcttcaagactaaaccaagtcaatctggaatacg |
34256736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University