View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16168_low_1 (Length: 278)
Name: NF16168_low_1
Description: NF16168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16168_low_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 10 - 260
Target Start/End: Complemental strand, 38484162 - 38483912
Alignment:
| Q |
10 |
gcacagatgagggaaacatataggttcatttcataaaacatacccaacgaaaaggttcaattctagaagcattgtttacagtacacatgaaaagttggcg |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38484162 |
gcacagatgagggaaacatataggttcatttcataaaacatacccaacgaaaaggttcaattctagaagcattgtttacagtacacatgaaaagttggcg |
38484063 |
T |
|
| Q |
110 |
gttagcagcactgaaatcgataaagacagggagtgtcaattatacacaactaagaacttttgagaggggattgcaaagttccttatgacccaaataattc |
209 |
Q |
| |
|
|| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38484062 |
gtaagcagcactgaaatcgataaagacggggagtgtcaattatacacaactaagaacttttgagaggggattgcaaagttccttatgacccaaataattc |
38483963 |
T |
|
| Q |
210 |
agttataaatatgccaacagcattgcattggttatgtccttgttgaggtat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38483962 |
agttataaatatgccaacagcattgcattggttatgtccttgttgaggtat |
38483912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University