View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1616_low_8 (Length: 212)
Name: NF1616_low_8
Description: NF1616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1616_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 4 - 171
Target Start/End: Complemental strand, 8518763 - 8518598
Alignment:
| Q |
4 |
agtcttcatcttaataactttctgaggcaaatatcatattctgtactcagccagcttctgtttcataattcatattccaattccttataaaaccatagat |
103 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8518763 |
agtcttcatcttaataactttctgaggcaaatatcatattctg--ctcagccagcttctgtttcataattcatattccaattccttataaaaccatagat |
8518666 |
T |
 |
| Q |
104 |
tatgaaaatggggcataacccatatgtcataattaagaagttctctaaccaagtaattttatctaagg |
171 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8518665 |
tctgaaaatggggcataacccatatgtcataattaagaagttctctaacaaagtaattttatctaagg |
8518598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University