View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1617-INSERTION-6 (Length: 139)
Name: NF1617-INSERTION-6
Description: NF1617
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1617-INSERTION-6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 132; Significance: 6e-69; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 132; E-Value: 6e-69
Query Start/End: Original strand, 6 - 137
Target Start/End: Original strand, 3659979 - 3660110
Alignment:
| Q |
6 |
catcatgaacgctctcctcattctctaaaccttcctcatcatctccataaaccttacacaatttgctaatcttctcaactctccccctcaaattcttcaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3659979 |
catcatgaacgctctcctcattctctaaaccttcctcatcatctccataaaccttacacaatttgctaatcttctcaactctccccctcaaattcttcaa |
3660078 |
T |
 |
| Q |
106 |
cagcttcttcttctcatcatcatcaccttctg |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3660079 |
cagcttcttcttctcatcatcatcaccttctg |
3660110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University