View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16171_low_7 (Length: 295)
Name: NF16171_low_7
Description: NF16171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16171_low_7 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 43 - 277
Target Start/End: Complemental strand, 42273171 - 42272936
Alignment:
| Q |
43 |
tatattcctaatcactatagcattatttatcatcccacagtttgacattcctcttatgtcaaatgctccatgatatcatacaaaacatggatagcagcac |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
42273171 |
tatattcctaatcactatagcattatttatcatcccaaagtttgacattcctcttatgtcaaacgctccatgatatcatacaaaacatggatagcagcac |
42273072 |
T |
|
| Q |
143 |
cagcacctgcaccagccatataatgactcattttgccaacaacgattgttggggtaaactagaagcaaatgccataa-nnnnnnnngttctttgatcaca |
241 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42273071 |
cagcacctgcaccagccataaaatgactcattttgccaacaacgattgttggggtaaactagaagcaaatgccataatttttttttgttctttgatcaca |
42272972 |
T |
|
| Q |
242 |
atagatgtaagaagaaggacagtaaacgcctttctt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42272971 |
atagatgtaagaagaaggacagtaaacgcctttctt |
42272936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University