View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16172_high_12 (Length: 418)
Name: NF16172_high_12
Description: NF16172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16172_high_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 368; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 368; E-Value: 0
Query Start/End: Original strand, 23 - 402
Target Start/End: Complemental strand, 29238848 - 29238469
Alignment:
| Q |
23 |
aagttcgtcttcccggtcgtcgacgacggcctctaccaacctaaaagtaacaaaacccgcgcggcctacaacaatctgctcactcttatccagcagccac |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29238848 |
aagttcgtcttcccggtcgtcgacgacggcctctaccaacctaaaactaacaaaacccgcgcggcctacaacaatctgctcactcttatccagcagccac |
29238749 |
T |
 |
| Q |
123 |
gccctggtcagcctcttgccggtcagccgctcagtactgtcagattcgtggctgataagatacttgaaattctcaaaaatgatgttgttaattactatga |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29238748 |
gccctggtcagcctcttgccggtcagccgctcagtactgtcagattcgtggctgataagatacttgaaattctcaaaaatgatgctgttaattactatga |
29238649 |
T |
 |
| Q |
223 |
caagaagattaacattgagatgcttcttaaccctatccctaaccatgtcttcgaacagattgtcgaaattggtaaacttataaccgatttctatgggttt |
322 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29238648 |
caagaagattaacattgagatgcttcttaaccctatccctaaccatgtcttcgaacagattgtcgaaattggtaaacttataaccgatttctatgggttt |
29238549 |
T |
 |
| Q |
323 |
gctgctggtgctcatgtcgatggtggcgttgtcgatggtttacagaagatgtctatttgcagcaataatgatagtgttgt |
402 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29238548 |
gctgctggtgctcatgtcgatggtggcgttgtcgatagtttacagaagatgtctatttgcagcaataatgatagtgttgt |
29238469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University