View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16172_high_17 (Length: 351)
Name: NF16172_high_17
Description: NF16172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16172_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 49 - 115
Target Start/End: Complemental strand, 40290208 - 40290145
Alignment:
| Q |
49 |
aattaagagataattttgtatctcatgtggtaagtgctcacaatgtttctatatgtgtgttgtttaa |
115 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40290208 |
aattaagagataat---gtatctcatgtggtaagtgctcacaatgtttctatatgtgtgttgtttaa |
40290145 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University