View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16172_high_24 (Length: 280)
Name: NF16172_high_24
Description: NF16172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16172_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 7 - 131
Target Start/End: Complemental strand, 43663260 - 43663136
Alignment:
| Q |
7 |
tattcttctaaaccatatgtaggtttttcctttacctaaaaccacatgtctataggtaaaggtcatgctagaagagtgacacatatataactacgattta |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43663260 |
tattcttctaaaccatatgtaggtttttcttttacctaaaaccacatgtctataggtaaaggtcatgctagaagagtgacacatatataactacgattta |
43663161 |
T |
 |
| Q |
107 |
gttctttgttataataggtggtgtt |
131 |
Q |
| |
|
||| |||||||| |||||||||||| |
|
|
| T |
43663160 |
gttgtttgttattataggtggtgtt |
43663136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 242 - 280
Target Start/End: Complemental strand, 43663025 - 43662987
Alignment:
| Q |
242 |
gataaataaaataaagaatataaagggtttgatttcatt |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43663025 |
gataaataaaataaagaatataaagggtttgatttcatt |
43662987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University