View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16172_high_28 (Length: 247)
Name: NF16172_high_28
Description: NF16172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16172_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 11 - 221
Target Start/End: Complemental strand, 45130647 - 45130430
Alignment:
| Q |
11 |
gaagaagtattccaagtatacagtaataattatctttttgctgctgaaaatagctatatagacaagacccagcacaccgtggtaattgctctct------ |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45130647 |
gaagaagtattccaagtatacagtaataattatctttttgttgctgaaaatagttatatagacaagacccagcacaccgtggtaattgctctctctctct |
45130548 |
T |
 |
| Q |
105 |
----gtcacatctctttcaacaccaataatatttgaggcctgccattaaaaaagttaaaattgtaatcatatttataatagactagaaaacacaaattcc |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45130547 |
ctctgtcacatctctttcaacaccaata---tttcaggcctgccattaaaaaagttaaaattgtaatcatatttataatagactagaatacacaaattcc |
45130451 |
T |
 |
| Q |
201 |
acccaccacattgccccacca |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
45130450 |
acccaccacattgccccacca |
45130430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University