View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16172_high_30 (Length: 239)

Name: NF16172_high_30
Description: NF16172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16172_high_30
NF16172_high_30
[»] chr8 (1 HSPs)
chr8 (1-222)||(33049586-33049807)


Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 33049586 - 33049807
Alignment:
1 tccttccgcatttcctccggcgccggtgctgattgctccggtgcataaacgaggagagatccgtcggagcatcctaagaggagtttggaaccgtaggatt 100  Q
    |||||||||||||||||||| |||||| |||| ||||| || |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
33049586 tccttccgcatttcctccggagccggtactgaatgctctggcgcataaacgaggagagatccgttggagcatcctaagaggagtttggaaccgtaggatt 33049685  T
101 cgatggattcgattttggagggtgagtttgtgagaagctcgaaggaatcataagcagtgtgcaccattgttgagaaattgcattgacgagtgaaaatgga 200  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
33049686 cgatggattcgattttggaggttgagtttgtgagaagctcgaaggaatcataagcagtgtgcaccattgttgagaaattgcattgacgagtgaaaatgga 33049785  T
201 aatttcaggaaacgatgtcgtt 222  Q
    ||||||||||||||||||||||    
33049786 aatttcaggaaacgatgtcgtt 33049807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University