View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16172_high_32 (Length: 232)

Name: NF16172_high_32
Description: NF16172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16172_high_32
NF16172_high_32
[»] chr6 (4 HSPs)
chr6 (132-215)||(9356065-9356148)
chr6 (135-215)||(9348043-9348123)
chr6 (1-58)||(9347901-9347959)
chr6 (132-193)||(9360613-9360674)


Alignment Details
Target: chr6 (Bit Score: 72; Significance: 7e-33; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 132 - 215
Target Start/End: Original strand, 9356065 - 9356148
Alignment:
132 gtgataatggtaattgcagggaaaagctgtagattaagatggcttaatcagctagatcctagcatcaaaagagaacctttaagt 215  Q
    |||||||||||||||||||||||||| ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||    
9356065 gtgataatggtaattgcagggaaaagttgtagattaaggtggcttaatcacctagatcctagcatcaaaagagaacctttaagt 9356148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 135 - 215
Target Start/End: Original strand, 9348043 - 9348123
Alignment:
135 ataatggtaattgcagggaaaagctgtagattaagatggcttaatcagctagatcctagcatcaaaagagaacctttaagt 215  Q
    |||||| |||||||||||||||| ||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||    
9348043 ataatgataattgcagggaaaagttgtagattaaggtggcttaatcacctagatcctagcatcaaaagagaacctttaagt 9348123  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 9347901 - 9347959
Alignment:
1 taaaaaattgaatattttcaagctgtacgtttagta-ttttttattaaaattgcataag 58  Q
    |||||||||||| |||||||||| |||||||||||| ||||||||||||||||||||||    
9347901 taaaaaattgaacattttcaagcggtacgtttagtatttttttattaaaattgcataag 9347959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 132 - 193
Target Start/End: Original strand, 9360613 - 9360674
Alignment:
132 gtgataatggtaattgcagggaaaagctgtagattaagatggcttaatcagctagatcctag 193  Q
    |||||||||||||||| ||||||||| || |||||||| |||  ||||||||||||||||||    
9360613 gtgataatggtaattgaagggaaaagttgcagattaaggtggtgtaatcagctagatcctag 9360674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University