View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16172_high_32 (Length: 232)
Name: NF16172_high_32
Description: NF16172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16172_high_32 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 72; Significance: 7e-33; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 132 - 215
Target Start/End: Original strand, 9356065 - 9356148
Alignment:
| Q |
132 |
gtgataatggtaattgcagggaaaagctgtagattaagatggcttaatcagctagatcctagcatcaaaagagaacctttaagt |
215 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9356065 |
gtgataatggtaattgcagggaaaagttgtagattaaggtggcttaatcacctagatcctagcatcaaaagagaacctttaagt |
9356148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 135 - 215
Target Start/End: Original strand, 9348043 - 9348123
Alignment:
| Q |
135 |
ataatggtaattgcagggaaaagctgtagattaagatggcttaatcagctagatcctagcatcaaaagagaacctttaagt |
215 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9348043 |
ataatgataattgcagggaaaagttgtagattaaggtggcttaatcacctagatcctagcatcaaaagagaacctttaagt |
9348123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 1 - 58
Target Start/End: Original strand, 9347901 - 9347959
Alignment:
| Q |
1 |
taaaaaattgaatattttcaagctgtacgtttagta-ttttttattaaaattgcataag |
58 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
9347901 |
taaaaaattgaacattttcaagcggtacgtttagtatttttttattaaaattgcataag |
9347959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 132 - 193
Target Start/End: Original strand, 9360613 - 9360674
Alignment:
| Q |
132 |
gtgataatggtaattgcagggaaaagctgtagattaagatggcttaatcagctagatcctag |
193 |
Q |
| |
|
|||||||||||||||| ||||||||| || |||||||| ||| |||||||||||||||||| |
|
|
| T |
9360613 |
gtgataatggtaattgaagggaaaagttgcagattaaggtggtgtaatcagctagatcctag |
9360674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University