View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16172_low_17 (Length: 354)
Name: NF16172_low_17
Description: NF16172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16172_low_17 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 226 - 331
Target Start/End: Original strand, 8296504 - 8296609
Alignment:
| Q |
226 |
cactcctgacacacttataatgtgctgacaactgtttcctaatttttagggaaaatgaaaaaggagcacaaactatattagaagctcttataaaatatga |
325 |
Q |
| |
|
||||||| ||||||||||||| ||||||||||||||||||| ||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
8296504 |
cactccttacacacttataatatgctgacaactgtttcctattttgtggggaaaatgaaaaagaagcacaaactatattagaagctcttataaaatatga |
8296603 |
T |
|
| Q |
326 |
aggggc |
331 |
Q |
| |
|
|||||| |
|
|
| T |
8296604 |
aggggc |
8296609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 31 - 128
Target Start/End: Complemental strand, 15163144 - 15163048
Alignment:
| Q |
31 |
gtgagatgaatgggaatttgtatggctaatgtgaaatatcaagtgcttgtaaatggtgatggtattggtttacagggatcctggtaaaggcttacgac |
128 |
Q |
| |
|
|||| |||||||||||||||||||| |||||| |||||||||||| |||||||||||||||||||||||||| | |||||||| | ||||||||||| |
|
|
| T |
15163144 |
gtgacatgaatgggaatttgtatggataatgtaaaatatcaagtgtttgtaaatggtgatggtattggtttata-agatcctggaagaggcttacgac |
15163048 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 31 - 104
Target Start/End: Original strand, 14343495 - 14343568
Alignment:
| Q |
31 |
gtgagatgaatgggaatttgtatggctaatgtgaaatatcaagtgcttgtaaatggtgatggtattggtttaca |
104 |
Q |
| |
|
|||| ||| |||| ||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
14343495 |
gtgaaatggatggaaatttgtatggctaatgtgaagtatcaagtgcttgtaaacaatgatggtattggtttaca |
14343568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University