View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16172_low_26 (Length: 280)

Name: NF16172_low_26
Description: NF16172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16172_low_26
NF16172_low_26
[»] chr3 (2 HSPs)
chr3 (7-131)||(43663136-43663260)
chr3 (242-280)||(43662987-43663025)


Alignment Details
Target: chr3 (Bit Score: 113; Significance: 3e-57; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 7 - 131
Target Start/End: Complemental strand, 43663260 - 43663136
Alignment:
7 tattcttctaaaccatatgtaggtttttcctttacctaaaaccacatgtctataggtaaaggtcatgctagaagagtgacacatatataactacgattta 106  Q
    ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43663260 tattcttctaaaccatatgtaggtttttcttttacctaaaaccacatgtctataggtaaaggtcatgctagaagagtgacacatatataactacgattta 43663161  T
107 gttctttgttataataggtggtgtt 131  Q
    ||| |||||||| ||||||||||||    
43663160 gttgtttgttattataggtggtgtt 43663136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 242 - 280
Target Start/End: Complemental strand, 43663025 - 43662987
Alignment:
242 gataaataaaataaagaatataaagggtttgatttcatt 280  Q
    |||||||||||||||||||||||||||||||||||||||    
43663025 gataaataaaataaagaatataaagggtttgatttcatt 43662987  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University