View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16172_low_29 (Length: 250)
Name: NF16172_low_29
Description: NF16172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16172_low_29 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 29239136 - 29238902
Alignment:
| Q |
16 |
atgacattgtccatttaattttagcaaaatcagaggacctaacttagatatgttagcccttgatcgactatttaagctaatagtgtttaacttttttaca |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
29239136 |
atgacattgtccatttaattttagcaaaatcagaggacctaacttagatattttagcccttgatcgactatttaagcaaatagtgtgtaacttttttaca |
29239037 |
T |
|
| Q |
116 |
attagggttcttcttgaatcgcctcggtgtttccaaacatggcagactcgcggttcaaccaatacaactacaccggtgcacatctagtcttcttccctcc |
215 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29239036 |
attagggttcttcttgaaccgcctcggtgtttccaaacatggcagactcgcggttcaaccaatacaactacaccggtgcacatctagtcttcttccctcc |
29238937 |
T |
|
| Q |
216 |
cgctcgcgaaatccccataccaaacgctgaaccac |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
29238936 |
cgctcgcgaaatccccataccaaacgctgaaccac |
29238902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University