View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16174_low_10 (Length: 215)
Name: NF16174_low_10
Description: NF16174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16174_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 196
Target Start/End: Original strand, 3101757 - 3101952
Alignment:
| Q |
1 |
acatgctatctttgtggcgtagtaatgtttcgtttataatttctaccttgtattgcaggggaaagattaggagtatggctagctcttttcccaacagttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3101757 |
acatgctatctttgtggcgtagtaatgtttcatttataatttctaccttgtattgcaggggaaagattaggagtatggctagctcttttcccaacagttt |
3101856 |
T |
 |
| Q |
101 |
atttatcagcaggaactgcaacagctttgattcttgttggaggggagaccatgaaactgttctttcaaatagtttgtggtccaacatgtacctcaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3101857 |
atttatcagcaggaactgcaacagctttgattcttgttggaggggagaccatgaaactgttctttcaaatagtttgtggtccaacatgtacctcaa |
3101952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University